I'm working on custom hardware, and have added a new myboard board to my U-boot repro. The make pattern is very standard:
make myboard_defconfig
make
which sets the U-Boot configuration to the myboard defaults, and then builds the resulting U-boot image. It all works, but I need to take it one step further.
The hardware actually comes in two closely-related flavors, and I need to build slightly different U-Boot images for the two flavors. Rather than defining two completely different boards, I'd like to build the same board type twice, but with a CONFIG_MYBOARD_XXXX symbol having different values. My myboard.c file will then have an #if CONFIG_MYBOARD_XXXX == YYYY test to differentiate the results.
Problem: I want to set CONFIG_MYBOARD_XXXX's value from within my parent Makefile, not by running anything interactive like make menuconfig.
What's the "right" way to do this?
The U-boot make process has a lot of magic in it, and there seems to be a number of unstated rules on how files need to be named. So, I assumed that the configs/myboard_defconfig file, and the argument to make myboard_defconfig, had to match the official name of my board followed by _defconfig.
Turns out I was wrong: these files can be named anything, as long as they end in _defconfig. So, to have two closely-related versions of myboard, I just have two different defconfig files, e.g. myboard_one_defconfig and myboard_two_defconfig, with the configuration values in the two files specifying the configuration for the two different flavors of myboard.
Easy peasy!
Related
I have the following scenario:
I have a remote server that every week gets loaded with 2 files, these files have the following name format:
"FINAL_NAME06Apr16.txt" and
"FINAL_NAME_F106Apr16.txt"
The part in bold is fixed everytime, but the date changes, now, I need to pick, copy to another directory and rename these files. but I'm not sure about how to pick the name of the files to variables to operate with them as I need to put different name to each file.
How can I proceed? I' pretty sure it has to be done with naming a variable with an expression, but I don't know how to do that part.
I think I need some function to calculate the rest of the filename, I believe maybe some approach could be to first rename the part "FINAL_NAME_F1" and then rename the "FINAL_NAME" since some wildcards will pick both if don't do it that way?
Cheers.
You can calculate the date but why go through that complexity?
A Foreach (File) Loop Container, FELC, will handle this just fine. Add two of them to your control flow.
The first one will use a file mask of FINAL_NAME_F1*.txt. Inside that FELC, use a File System task to copy/move/rename the file to your new location.
That first FELC will run, find the target file and move it. It will then look for the next file, find none and go on to the next task.
Create a second FELC but this one will operate on FINAL_NAME*.txt It's crucial that the first FELC run first as this file mask will match both FINAL_NAME_f1-2019-01-01.txt and FINAL_NAME-2019-01-01.txt. By ordering our operations as such, we can reduce the complexity of the logic required.
Sample answer with a FELC to show where to plumb the various bits
I'm completely new to tcl and am trying to understand how to script the command "adapter usb location" in openOCD.
From the openOCD manual, the command has this description:
I want to point it to the port with the red arrow below:
Thanks.
It's not 100% clear, but I would expect (from that snippet of documentation) a bus location to be a dotted “path” something like:
1-6
where the values are:
1 — Bus ID
6 — Port ID
Which would result in a call to the command being done like this:
adapter usb location 1-6
When there's a more complex structure involved (internally because of chained hubs) such as with the item above the one you pointed at, I'd instead expect:
1-5.3
Notice that there are is a sequence of port IDs (5.3) in there to represent the structure. The resulting call would then be:
adapter usb location 1-5.3
Now for the caveats!
I can't tell what the actual format of those IDs is. They might just be numbers, or they might have some textual prefix (e.g., bus1-port6). Those text prefixes, if present, might contain a space (or other metacharacter) which will be deeply annoying to use if true. You should be able to run adapter usb location without any other arguments to see what the current location is; be aware though that it might return the empty string (or give an error) if there is no current location. I welcome feedback on this, as that information appears to be not present in any online documentation I can find (and I don't have things installed so I can't just check).
I also have no idea what (if anything) to do with the device and interface IDs.
I've already looked here and in other forums, but couldn't find the answer to my question. I want to design baits for a target enrichment Sequencing approach and have the output of a MarkerMiner search for orthologous loci from four different genomes with A. thaliana as a Reference as. These output alignments are separate Fasta-Files for each A. thaliana annotated gene with the sequences from my datasets aligned to it.
I have already run a script to filter out those loci supported to be orthologous by at least two of my four input datasets.
However, now, I'm stumped.
My alignments are gappy, since the input data is mostly RNAseq whereas the Reference contains the introns as well. So it looks like this :
AT01G1234567
ATCGATCGATGCGCGCTAGCTGAATCGATCGGATCGCGGTAGCTGGAGCTAGSTCGGATCGC
MyData1
CGATGCGCGC-----------CGGATCGCGG---------------CGGATCGC
MyData2
CGCTGCGCGC------------GGATAGCGG---------------CGGATCCC
To effectively design baits I now need to extract all the aligned parts from the file, so that I will end up with separate files; or separate alignments within the file; for the parts that are aligned between MyData and the Reference sequence with all the gappy parts excluded. There are about 1300 of these fasta files, so doing it manually is no option.
I have a bit of programming experience in python and with Linux command line tools, however I am completely lost on how to go about this. I would appreciate a hint, on what kind of tools are out there I could use or what kind of algorithm I need to come up with.
Thank you.
Cheers
I'm importing a flat file into a database using a Data Flow Task in SSIS. The file is very simple: it contains three comma-separated values per row. Whenever I run this task, however, I receive a warning from the Flat File component:
Warning: 0x8020200F: There is a partial row at the end of the file.
This warning seems to happen regardless of the size of the file: even with only a handful of rows in the file, visually validated (with extended characters and whatnot visible) I still receive it. Moreover, it doesn't seem to matter whether I have a blank row at the end of the file or I just end it without a trailing CR+LF.
How can I get rid of this warning so I can run my package with WarnAsError enabled?
(BTW, it seems someone else may have had a similar problem in There is a partial row at the end of the file, though it wasn't much of a question.)
I have found three things to try if you encounter this problem. In at least two out of the three cases, SSIS was ignoring rows of my input file with only the above warning to show for it. Because of that, I do not recommend ignoring this warning!
Step 1: verify that your flat file is valid
This error will appear when you have an invalid input file. This can be especially hard to detect if your input file has millions of lines, as mine do, but it's vital that you discover file format violations because SSIS will happily give you this warning and continue on its way without importing the offending lines or, in some cases, the lines after the offending lines. The easiest way I found to discover a problem with the source file is to check the number of rows that are being imported successfully. If it's vastly different than the number you expect in your flat file, something may have gone wrong in the middle somewhere.
Step 2: try a dummy line at the end (fixed-width only)
If you are using a fixed-width format input file, Microsoft may have a helpful KB article for you. Basically, they suggest that you add a dummy line at the end of the file.
I am not using fixed-width files, so I can't say how useful this technique is.
Step 3: turn off text qualification for non-text
This is the tricky one, because I believe the TextQualified property is True by default. If your input file uses non-text fields (integers, etc.), then you must tell SSIS that it should not expect those columns to be qualified as text. Essentially, your input file will be invalid in spite of looking perfectly valid.
TextQualified is a property of the columns in your Flat File Connection Manager.
To change it, open up your connection manager, click "Advanced", and then click on a non-text column. Make sure the TextQualified property is set to False. You will need to do this for all of your non-text columns.
If the byte width of a line in the file is known, you can always double check that the total byte size of the file can be divided by the expected line size to give you a nice round line count number (as opposed to a decimal).
It helps also to know from your source just how many records are expected, but if you don't have this you can at least double check the resultant loaded tables record count against the calculation of line count while loading the file.
I've seen this error often when a source flat text file is missing it's last \r\n at the end of the file.
Running on Windows 64 bit is perfect. It led to no missing row, but I lost the last row when running on Windows 2008.
My workaround is
1. open the ssis in BIDs on the Windows 2008.
2. open the file connection manager make sure Text Qualifier set to
3. rebuild it
All work fine in both Windows 7 and Windows 2008.
As of now I use 3 Notebook :
Functions
Where I have all the functions I created and call in the other Notebooks.
Transformation
Based on the original data, I compute transformations and add columns/List
When data is my raw data, I then call :
t1data : the result of the first transformation
t2data : the result of the second transformation
and so on,
I am yet at t20.
Display & Analysis
Using both the above I create Manipulate object that enable me to analyze the data.
Questions
Is there away to save the results of the Transformation Notebook such that t13data for example can be used in the Display & Analysis Notebooks without running all the previous computations (t1,t2,t3...t12) it is based on ?
Is there a way to use my Functions or transformed data without opening the corresponding Notebook ?
Does my separation strategy make sense at all ?
As of now I systematically open the 3 and have to run them all before being able to do anything, and it takes a while given my poor computing power and yet inefficient codes.
Saving variable states: can be done using DumpSave, Save or Put. Read back using Get or <<
You could make a package from your functions and read those back using Needs or <<
It's not something I usually do. I opt for a monolithic notebook containing everything (nicely layered with sections and subsections so that you can fold open or close) or for a package + slightly leaner analysis notebook depending on the weather and some other hidden variables.
Saving intermediate results
The native file format for Mathematica expressions is the .m file. This is human readable text format, and you can view the file in a text editor if you ever doubt what is, or is not being saved. You can load these files using Get. The shorthand form for Get is:
<< "filename.m"
Using Get will replace or refresh any existing assignments that are explicitly made in the .m file.
Saving intermediate results that are simple assignments (dat = ...) may be done with Put. The shorthand form for Put is:
dat >> "dat.m"
This saves only the assigned expression itself; to restore the definition you must use:
dat = << "dat.m"
See also PutAppend for appending data to a .m file as new results are created.
Saving results and function definitions that are complex assignments is done with Save. Examples of such assignments include:
f[x_] := subfunc[x, 2]
g[1] = "cat"
g[2] = "dog"
nCr = #!/(#2! (# - #2)!) &;
nPr = nCr[##] #2! &;
For the last example, the complexity is that nPr depends on nCr. Using Save it is sufficient to save only nPr to get a fully working definition of nPr: the definition of nCr will automatically be saved as well. The syntax is:
Save["nPr.m", nPr]
Using Save the assignments themselves are saved; to restore the definitions use:
<< "nPr.m" ;
Moving functions to a Package
In addition to Put and Save, or manual creation in a text editor, .m files may be generated automatically. This is done by creating a Notebook and setting Cell > Cell Properties > Initialization Cell on the cells that contain your function definitions. When you save the Notebook for the first time, Mathematica will ask if you want to create an Auto Save Package. Do so, and Mathematica will generate a .m file in parallel to the .nb file, containing the contents of all Initialization Cells in the Notebook. Further, it will update this .m file every time you save the Notebook, so you never need to manually update it.
Sine all Initialization Cells will be saved to the parallel .m file, I recommend using the Notebook only for the generation of this Package, and not also for the rest of your computations.
When managing functions, one must consider context. Not all functions should be global at all times. A series of related functions should often be kept in its own context which can then be easily exposed to or removed from $ContextPath. Further, a series of functions often rely on subfunctions that do not need to be called outside of the primary functions, therefore these subfunctions should not be global. All of this relates to Package creation. Incidentally, it also relates to the formatting of code, because knowing that not all subfunctions must be exposed as global gives one the freedom to move many subfunctions to the "top level" of the code, that is, outside of Module or other scoping constructs, without conflicting with global symbols.
Package creation is a complex topic. You should familiarize yourself with Begin, BeginPackage, End and EndPackage to better understand it, but here is a simple framework to get you started. You can follow it as a template for the time being.
This is an old definition I used before DeleteDuplicates existed:
BeginPackage["UU`"]
UnsortedUnion::usage = "UnsortedUnion works like Union, but doesn't \
return a sorted list. \nThis function is considerably slower than \
Union though."
Begin["`Private`"]
UnsortedUnion =
Module[{f}, f[y_] := (f[y] = Sequence[]; y); f /# Join###] &
End[]
EndPackage[]
Everything above goes in Initialization Cells. You can insert Text cells, Sections, or even other input cells without harming the generated Package: only the contents of the Initialization Cells will be exported.
BeginPackage defines the Context that your functions will belong to, and disables all non-System` definitions, preventing collisions. (There are ways to call other functions from your package, but that is better for another question).
By convention, a ::usage message is defined for each function that it to be accessible outside the package itself. This is not superfluous! While there are other methods, without this, you will not expose your function in the visible Context.
Next, you Begin a context that is for the package alone, conventionally "`Private`". After this point any symbols you define (that are not used outside of this Begin/End block) will not be exposed globally after the Package is loaded, and will therefore not collide with Global` symbols.
After your function definition(s), you close the block with End[]. You may use as many Begin/End blocks as you like, and I typically use a separate one for each function, though it is not required.
Finally, close with EndPackage[] to restore the environment to what it was before using BeginPackage.
After you save the Notebook and generate the .m package (let's say "mypackage.m"), you can load it with Get:
<< "mypackage.m"
Now, there will be a function UnsortedUnion in the Context UU` and it will be accessible globally.
You should also look into the functionality of Needs, but that is a little more advanced in my opinion, so I shall stop here.